SRR12540267 (PRJNA660002)
Processing Status: Completed
General Details
| Sample Name | GSM4751855 |
|---|---|
| Organism | Homo sapiens |
| Release Date | 10/2020 |
Sample Links
| GWIPS-viz | Trips-Viz | Custom Track |
|---|---|---|
Run Details
| Spots | 40798612 |
|---|---|
| Total Bases | 2692708392 |
| Total Bases | 2692708392 |
Repository Details
| SRA | SRR12540267 |
|---|---|
| ENA | SRR12540267 |
| BioProject | PRJNA660002 |
Experiment Details
| Title | HCT-116 cells with DDX3X degron, DMSO treated, ribosome profiling, replicate 1 |
|---|
Sample Details
| Run Accession | SRR12540267 |
|---|---|
| Total Number Of Spots (Original File)) | 40798612 |
| Total Number Of Bases (Original File) | 2692708392 |
| Average Read Length | 66 |
| Original File Size (Mb) | 919 |
| Experiment Id | SRX9029926 |
| Library Strategy | OTHER |
| Library Selection | other |
| Library Source | TRANSCRIPTOMIC |
| Library Layout | SINGLE |
| Insert Size | 0 |
| Insert Deviation | 0 |
| Platform | ILLUMINA |
| Model | Illumina HiSeq 4000 |
| Sra Project Accession (Srp) | SRP279211 |
| Pubmed Id | 33905506 |
| Sample | SRS7281231 |
| Biosample | SAMN15932206 |
| Sample Type | simple |
| Organism Taxid | 9606 |
| Organism | Homo sapiens |
| Sample Name | GSM4751855 |
| Center Name | GEO |
| Submission | SRA1118483 |
| Month | 10 |
| Year | 2020 |
| Author | Calviello |
| Sample Source | HCT-116 with DDX3X degron, DMSO treated, ribosome profiling |
| Sample Title | HCT-116 cells with DDX3X degron, DMSO treated, ribosome profiling, replicate 1 |
| Library-Type | Ribo-Seq |
| Replicate-Number | 1.0 |
| Condition | Control |
| Tissue | Colon |
| Cell-Line | HCT116 |
| Cellular-Compartment | DMSO |
| Genotype | HCT-116 pCMV-OsTIR1 DDX3X-mAID |
| Adapter Sequence | TAGACAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC |
| Run Accession | Study Accession | Scientific Name | Description | Cell Line | Library Type | Treatment | Trips-Viz | GWIPS-viz | Reads | BAM | BigWig (F) | BigWig (R) | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SRR12540267 | Homo sapiens | HCT-116 with DDX3X degron, DMSO treated, ribosome profiling | HCT116 | Ribo-Seq |  |
 |
 |
 |
|
|
|||
| Run Accession | Study Accession | Scientific Name | Description | Cell Line | Library Type | Treatment | Trips-Viz | GWIPS-viz | Reads | BAM | BigWig (F) | BigWig (R) |
ⓘ For more Information on the columns shown here see: About