SRR12540267 (PRJNA660002)

General Details

View quality reports

Sample Name GSM4751855
Organism Homo sapiens
Release Date 10/2020

Sample Links

Run Details

Spots 40798612
Total Bases 2692708392
Total Bases 2692708392

Repository Details

SRA SRR12540267
ENA SRR12540267
BioProject PRJNA660002

Experiment Details

Title HCT-116 cells with DDX3X degron, DMSO treated, ribosome profiling, replicate 1

Sample Details

Run Accession SRR12540267
Total Number Of Spots (Original File)) 40798612
Total Number Of Bases (Original File) 2692708392
Average Read Length 66
Original File Size (Mb) 919
Experiment Id SRX9029926
Library Strategy OTHER
Library Selection other
Library Source TRANSCRIPTOMIC
Library Layout SINGLE
Insert Size 0
Insert Deviation 0
Platform ILLUMINA
Model Illumina HiSeq 4000
Sra Project Accession (Srp) SRP279211
Pubmed Id 33905506
Sample SRS7281231
Biosample SAMN15932206
Sample Type simple
Organism Taxid 9606
Organism Homo sapiens
Sample Name GSM4751855
Center Name GEO
Submission SRA1118483
Month 10
Year 2020
Author Calviello
Sample Source HCT-116 with DDX3X degron, DMSO treated, ribosome profiling
Sample Title HCT-116 cells with DDX3X degron, DMSO treated, ribosome profiling, replicate 1
Library-Type Ribo-Seq
Replicate-Number 1.0
Condition Control
Tissue Colon
Cell-Line HCT116
Cellular-Compartment DMSO
Genotype HCT-116 pCMV-OsTIR1 DDX3X-mAID
Adapter Sequence TAGACAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)
SRR12540267 Homo sapiens HCT-116 with DDX3X degron, DMSO treated, ribosome profiling HCT116 Ribo-Seq
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)

ⓘ For more Information on the columns shown here see: About