SRR12540269 (PRJNA660002)

Processing Status: Completed

General Details

View quality reports

Sample Name GSM4751857
Organism Homo sapiens
Release Date 10/2020

Sample Links

Run Details

Spots 29435952
Total Bases 1942772832
Total Bases 1942772832

Repository Details

SRA SRR12540269
ENA SRR12540269
BioProject PRJNA660002

Experiment Details

Title HCT-116 cells with DDX3X degron, auxin treated, ribosome profiling, replicate 1

Sample Details

Run Accession SRR12540269
Total Number Of Spots (Original File)) 29435952
Total Number Of Bases (Original File) 1942772832
Average Read Length 66
Original File Size (Mb) 655
Experiment Id SRX9029928
Library Strategy OTHER
Library Selection other
Library Source TRANSCRIPTOMIC
Library Layout SINGLE
Insert Size 0
Insert Deviation 0
Platform ILLUMINA
Model Illumina HiSeq 4000
Sra Project Accession (Srp) SRP279211
Pubmed Id 33905506
Sample SRS7281233
Biosample SAMN15932204
Sample Type simple
Organism Taxid 9606
Organism Homo sapiens
Sample Name GSM4751857
Center Name GEO
Submission SRA1118483
Month 10
Year 2020
Author Calviello
Sample Source HCT-116 with DDX3X degron, auxin treated, ribosome profiling
Sample Title HCT-116 cells with DDX3X degron, auxin treated, ribosome profiling, replicate 1
Library-Type Ribo-Seq
Replicate-Number 1.0
Condition Control
Tissue Colon
Cell-Line HCT116
Cellular-Compartment Auxin
Genotype HCT-116 pCMV-OsTIR1 DDX3X-mAID
Adapter Sequence TAGACAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)
SRR12540269 Homo sapiens HCT-116 with DDX3X degron, auxin treated, ribosome profiling HCT116 Ribo-Seq
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)

ⓘ For more Information on the columns shown here see: About