SRR15217936 (PRJNA749053)

Processing Status: Completed

General Details

View quality reports

Sample Name GSM5467434
Organism Homo sapiens
Release Date 11/2021

Sample Links

Run Details

Spots 18359018
Total Bases 1211695188
Total Bases 1211695188

Repository Details

SRA SRR15217936
ENA SRR15217936
BioProject PRJNA749053

Experiment Details

Title HCT-116 cells with DDX3X degron, lentiCTRL, DMSO treated, ribosome profiling, replicate 1

Sample Details

Run Accession SRR15217936
Total Number Of Spots (Original File)) 18359018
Total Number Of Bases (Original File) 1211695188
Average Read Length 66
Original File Size (Mb) 376
Experiment Id SRX11523887
Library Name 0.0
Library Strategy OTHER
Library Selection other
Library Source TRANSCRIPTOMIC
Library Layout SINGLE
Insert Size 0
Insert Deviation 0
Platform ILLUMINA
Model Illumina HiSeq 4000
Sra Project Accession (Srp) SRP329509
Pubmed Id 34535544
Sample SRS9561253
Biosample SAMN20351327
Sample Type simple
Organism Taxid 9606
Organism Homo sapiens
Sample Name GSM5467434
Center Name GEO
Submission SRA1263336
Month 11
Year 2021
Author Venkataramanan
Sample Source HCT-116 with DDX3X degron, lentiCTRL, DMSO treated, ribosome profiling
Sample Title HCT-116 cells with DDX3X degron, lentiCTRL, DMSO treated, ribosome profiling, replicate 1
Library-Type Ribo-Seq
Replicate-Number 1.0
Condition Wild Type
Inhibitor 0.0
Timepoint NANA
Tissue Colon
Cell-Line HCT116
Cellular-Compartment DMSO
Stage 0.0
Gene 0.0
Sex 0.0
Strain 0.0
Age 0.0
Infected 0.0
Disease 0.0
Genotype HCT-116 pCMV-OsTIR1 DDX3X-mAID lentiCTRL
Feeding 0.0
Temperature 0.0
Sirna 0.0
Sgrna 0.0
Shrna 0.0
Plasmid 0.0
Growth-Condition 0.0
Stress 0.0
Cancer 0.0
Microrna 0.0
Individual 0.0
Antibody Used 0.0
Ethnicity 0.0
Dose 0.0
Stimulation 0.0
Host Organism 0.0
Unique Molecular Identifier (Umi) 0.0
Adapter Sequence TAGACAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Mode Of Separation 0.0
Mode Of Rrna Depletion 0.0
Barcode Information 0.0
Nucelase Used 0.0
Kit Used 0.0
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)
SRR15217936 Homo sapiens HCT-116 with DDX3X degron, lentiCTRL, DMSO treated, ribosome profiling HCT116 Ribo-Seq 0.0
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)

ⓘ For more Information on the columns shown here see: About