SRR15217940 (PRJNA749053)
Processing Status: Completed
General Details
| Sample Name | GSM5467438 |
|---|---|
| Organism | Homo sapiens |
| Release Date | 11/2021 |
Sample Links
| GWIPS-viz | Trips-Viz | Custom Track |
|---|---|---|
Run Details
| Spots | 15091323 |
|---|---|
| Total Bases | 996027318 |
| Total Bases | 996027318 |
Repository Details
| SRA | SRR15217940 |
|---|---|
| ENA | SRR15217940 |
| BioProject | PRJNA749053 |
Experiment Details
| Title | HCT-116 cells with DDX3X degron, lentiCTRL, auxin treated, ribosome profiling, replicate 1 |
|---|
Sample Details
| Run Accession | SRR15217940 |
|---|---|
| Total Number Of Spots (Original File)) | 15091323 |
| Total Number Of Bases (Original File) | 996027318 |
| Average Read Length | 66 |
| Original File Size (Mb) | 307 |
| Experiment Id | SRX11523891 |
| Library Name | 0.0 |
| Library Strategy | OTHER |
| Library Selection | other |
| Library Source | TRANSCRIPTOMIC |
| Library Layout | SINGLE |
| Insert Size | 0 |
| Insert Deviation | 0 |
| Platform | ILLUMINA |
| Model | Illumina HiSeq 4000 |
| Sra Project Accession (Srp) | SRP329509 |
| Pubmed Id | 34535544 |
| Sample | SRS9561257 |
| Biosample | SAMN20351323 |
| Sample Type | simple |
| Organism Taxid | 9606 |
| Organism | Homo sapiens |
| Sample Name | GSM5467438 |
| Center Name | GEO |
| Submission | SRA1263336 |
| Month | 11 |
| Year | 2021 |
| Author | Venkataramanan |
| Sample Source | HCT-116 with DDX3X degron, lentiCTRL, auxin treated, ribosome profiling |
| Sample Title | HCT-116 cells with DDX3X degron, lentiCTRL, auxin treated, ribosome profiling, replicate 1 |
| Library-Type | Ribo-Seq |
| Replicate-Number | 1.0 |
| Condition | Wild Type |
| Inhibitor | 0.0 |
| Timepoint | NANA |
| Tissue | Colon |
| Cell-Line | HCT116 |
| Cellular-Compartment | Auxin |
| Stage | 0.0 |
| Gene | 0.0 |
| Sex | 0.0 |
| Strain | 0.0 |
| Age | 0.0 |
| Infected | 0.0 |
| Disease | 0.0 |
| Genotype | HCT-116 pCMV-OsTIR1 DDX3X-mAID lentiCTRL |
| Feeding | 0.0 |
| Temperature | 0.0 |
| Sirna | 0.0 |
| Sgrna | 0.0 |
| Shrna | 0.0 |
| Plasmid | 0.0 |
| Growth-Condition | 0.0 |
| Stress | 0.0 |
| Cancer | 0.0 |
| Microrna | 0.0 |
| Individual | 0.0 |
| Antibody Used | 0.0 |
| Ethnicity | 0.0 |
| Dose | 0.0 |
| Stimulation | 0.0 |
| Host Organism | 0.0 |
| Unique Molecular Identifier (Umi) | 0.0 |
| Adapter Sequence | TAGACAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC |
| Mode Of Separation | 0.0 |
| Mode Of Rrna Depletion | 0.0 |
| Barcode Information | 0.0 |
| Nucelase Used | 0.0 |
| Kit Used | 0.0 |
| Run Accession | Study Accession | Scientific Name | Description | Cell Line | Library Type | Treatment | Trips-Viz | GWIPS-viz | Reads | BAM | BigWig (F) | BigWig (R) | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SRR15217940 | Homo sapiens | HCT-116 with DDX3X degron, lentiCTRL, auxin treated, ribosome profiling | HCT116 | Ribo-Seq | 0.0 |  |
 |
 |
 |
|
|
||
| Run Accession | Study Accession | Scientific Name | Description | Cell Line | Library Type | Treatment | Trips-Viz | GWIPS-viz | Reads | BAM | BigWig (F) | BigWig (R) |
ⓘ For more Information on the columns shown here see: About