SRR1803169 (PRJNA275386)

Processing Status: Completed

General Details

View quality reports

Sample Name GSM1609400
Organism Homo sapiens
Release Date 2/2015

Sample Links

Run Details

Spots 224349896
Total Bases 8076596256
Total Bases 8076596256

Repository Details

SRA SRR1803169
ENA SRR1803169
BioProject PRJNA275386

Experiment Details

Title GM18523_Rep3

Sample Details

Run Accession SRR1803169
Total Number Of Spots (Original File)) 224349896
Total Number Of Bases (Original File) 8076596256
Average Read Length 36
Original File Size (Mb) 5296
Experiment Id SRX876746
Library Name 0.0
Library Strategy OTHER
Library Selection other
Library Source TRANSCRIPTOMIC
Library Layout SINGLE
Insert Size 0
Insert Deviation 0
Platform ILLUMINA
Model Illumina HiSeq 2000
Sra Project Accession (Srp) SRP055009
Pubmed Id 26297486
Sample SRS845402
Biosample SAMN03344049
Sample Type simple
Organism Taxid 9606
Organism Homo sapiens
Sample Name GSM1609400
Center Name GEO
Submission SRA241011
Month 2
Year 2015
Author Cenik
Sample Source EBV-transformed lymphoblastoid cells
Sample Title GM18523_Rep3
Library-Type Ribo-Seq
Replicate-Number 3.0
Condition Test
Inhibitor Cycloheximide
Timepoint NANA
Tissue 0.0
Cell-Line LCL
Cellular-Compartment 0.0
Stage 0.0
Gene 0.0
Sex 0.0
Strain 0.0
Age 0.0
Infected 0.0
Disease 0.0
Genotype 0.0
Feeding 0.0
Temperature 0.0
Sirna 0.0
Sgrna 0.0
Shrna 0.0
Plasmid 0.0
Growth-Condition 0.0
Stress 0.0
Cancer 0.0
Microrna 0.0
Individual 0.0
Antibody Used 0.0
Ethnicity 0.0
Dose 0.0
Stimulation 0.0
Host Organism 0.0
Unique Molecular Identifier (Umi) 0.0
Adapter Sequence AGATCGGAAGAGCACACGTCT
Mode Of Separation 0.0
Mode Of Rrna Depletion 0.0
Barcode Information 0.0
Nucelase Used 0.0
Kit Used 0.0
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)
SRR1803169 Homo sapiens EBV-transformed lymphoblastoid cells LCL Ribo-Seq Cycloheximide
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)

ⓘ For more Information on the columns shown here see: About