SRR1803173 (PRJNA275386)
Processing Status: Completed
General Details
Sample Name | GSM1609404 |
---|---|
Organism | Homo sapiens |
Release Date | 2/2015 |
Sample Links
GWIPS-viz | Trips-Viz | Custom Track |
---|---|---|
Run Details
Spots | 118605985 |
---|---|
Total Bases | 4269815460 |
Total Bases | 4269815460 |
Repository Details
SRA | SRR1803173 |
---|---|
ENA | SRR1803173 |
BioProject | PRJNA275386 |
Experiment Details
Title | GM18951_Rep2 |
---|
Sample Details
Run Accession | SRR1803173 |
---|---|
Total Number Of Spots (Original File)) | 118605985 |
Total Number Of Bases (Original File) | 4269815460 |
Average Read Length | 36 |
Original File Size (Mb) | 2373 |
Experiment Id | SRX876750 |
Library Name | 0.0 |
Library Strategy | OTHER |
Library Selection | other |
Library Source | TRANSCRIPTOMIC |
Library Layout | SINGLE |
Insert Size | 0 |
Insert Deviation | 0 |
Platform | ILLUMINA |
Model | Illumina HiSeq 2000 |
Sra Project Accession (Srp) | SRP055009 |
Pubmed Id | 26297486 |
Sample | SRS845397 |
Biosample | SAMN03344040 |
Sample Type | simple |
Organism Taxid | 9606 |
Organism | Homo sapiens |
Sample Name | GSM1609404 |
Center Name | GEO |
Submission | SRA241011 |
Month | 2 |
Year | 2015 |
Author | Cenik |
Sample Source | EBV-transformed lymphoblastoid cells |
Sample Title | GM18951_Rep2 |
Library-Type | Ribo-Seq |
Replicate-Number | 2.0 |
Condition | Test |
Inhibitor | Cycloheximide |
Timepoint | NANA |
Tissue | 0.0 |
Cell-Line | LCL |
Cellular-Compartment | 0.0 |
Stage | 0.0 |
Gene | 0.0 |
Sex | 0.0 |
Strain | 0.0 |
Age | 0.0 |
Infected | 0.0 |
Disease | 0.0 |
Genotype | 0.0 |
Feeding | 0.0 |
Temperature | 0.0 |
Sirna | 0.0 |
Sgrna | 0.0 |
Shrna | 0.0 |
Plasmid | 0.0 |
Growth-Condition | 0.0 |
Stress | 0.0 |
Cancer | 0.0 |
Microrna | 0.0 |
Individual | 0.0 |
Antibody Used | 0.0 |
Ethnicity | 0.0 |
Dose | 0.0 |
Stimulation | 0.0 |
Host Organism | 0.0 |
Unique Molecular Identifier (Umi) | 0.0 |
Adapter Sequence | AGATCGGAAGAGCACACGTCT |
Mode Of Separation | 0.0 |
Mode Of Rrna Depletion | 0.0 |
Barcode Information | 0.0 |
Nucelase Used | 0.0 |
Kit Used | 0.0 |
ⓘ For more Information on the columns shown here see: About