SRR1803184 (PRJNA275386)
Processing Status: Completed
General Details
| Sample Name | GSM1609415 |
|---|---|
| Organism | Homo sapiens |
| Release Date | 2/2015 |
Sample Links
| GWIPS-viz | Trips-Viz | Custom Track |
|---|---|---|
| Visit Trips-Viz | Visit GWIPS-viz |
Run Details
| Spots | 180235842 |
|---|---|
| Total Bases | 9011792100 |
| Total Bases | 9011792100 |
Repository Details
| SRA | SRR1803184 |
|---|---|
| ENA | SRR1803184 |
| BioProject | PRJNA275386 |
Experiment Details
| Title | GM19200_Rep2 |
|---|
Sample Details
| Run Accession | SRR1803184 |
|---|---|
| Total Number Of Spots (Original File)) | 180235842 |
| Total Number Of Bases (Original File) | 9011792100 |
| Average Read Length | 50 |
| Original File Size (Mb) | 5666 |
| Experiment Id | SRX876761 |
| Library Strategy | OTHER |
| Library Selection | other |
| Library Source | TRANSCRIPTOMIC |
| Library Layout | SINGLE |
| Insert Size | 0 |
| Insert Deviation | 0 |
| Platform | ILLUMINA |
| Model | Illumina HiSeq 2000 |
| Sra Project Accession (Srp) | SRP055009 |
| Pubmed Id | 26297486 |
| Sample | SRS845386 |
| Biosample | SAMN03344012 |
| Sample Type | simple |
| Organism Taxid | 9606 |
| Organism | Homo sapiens |
| Sample Name | GSM1609415 |
| Center Name | GEO |
| Submission | SRA241011 |
| Month | 2 |
| Year | 2015 |
| Author | Cenik |
| Sample Source | EBV-transformed lymphoblastoid cells |
| Sample Title | GM19200_Rep2 |
| Library-Type | Ribo-Seq |
| Replicate-Number | 2.0 |
| Inhibitor | Cycloheximide |
| Cell-Line | lymphoblastoid |
| Adapter Sequence | AGATCGGAAGAGCACACGTCT |
| Run Accession | Study Accession | Scientific Name | Description | Cell Line | Library Type | Treatment | Trips-Viz | GWIPS-viz | Reads | BAM | BigWig (F) | BigWig (R) | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SRR1803184 | Homo sapiens | EBV-transformed lymphoblastoid cells | lymphoblastoid | Ribo-Seq | Cycloheximide |  |
 |
 |
 |
|
|
||
| Run Accession | Study Accession | Scientific Name | Description | Cell Line | Library Type | Treatment | Trips-Viz | GWIPS-viz | Reads | BAM | BigWig (F) | BigWig (R) |
ⓘ For more Information on the columns shown here see: About