SRR1803190 (PRJNA275386)

Processing Status: Completed

General Details

View quality reports

Sample Name GSM1609421
Organism Homo sapiens
Release Date 2/2015

Sample Links

Run Details

Spots 155542963
Total Bases 7777148150
Total Bases 7777148150

Repository Details

SRA SRR1803190
ENA SRR1803190
BioProject PRJNA275386

Experiment Details

Title GM19240_Rep1

Sample Details

Run Accession SRR1803190
Total Number Of Spots (Original File)) 155542963
Total Number Of Bases (Original File) 7777148150
Average Read Length 50
Original File Size (Mb) 4628
Experiment Id SRX876767
Library Strategy OTHER
Library Selection other
Library Source TRANSCRIPTOMIC
Library Layout SINGLE
Insert Size 0
Insert Deviation 0
Platform ILLUMINA
Model Illumina HiSeq 2000
Sra Project Accession (Srp) SRP055009
Pubmed Id 26297486
Sample SRS845381
Biosample SAMN03344002
Sample Type simple
Organism Taxid 9606
Organism Homo sapiens
Sample Name GSM1609421
Center Name GEO
Submission SRA241011
Month 2
Year 2015
Author Cenik
Sample Source EBV-transformed lymphoblastoid cells
Sample Title GM19240_Rep1
Library-Type Ribo-Seq
Replicate-Number 1.0
Inhibitor Cycloheximide
Cell-Line lymphoblastoid
Adapter Sequence AGATCGGAAGAGCACACGTCT
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)
SRR1803190 Homo sapiens EBV-transformed lymphoblastoid cells lymphoblastoid Ribo-Seq Cycloheximide
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)

ⓘ For more Information on the columns shown here see: About