SRR1803190 (PRJNA275386)
Processing Status: Completed
General Details
Sample Name | GSM1609421 |
---|---|
Organism | Homo sapiens |
Release Date | 2/2015 |
Sample Links
GWIPS-viz | Trips-Viz | Custom Track |
---|---|---|
Visit Trips-Viz | Visit GWIPS-viz |
Run Details
Spots | 155542963 |
---|---|
Total Bases | 7777148150 |
Total Bases | 7777148150 |
Repository Details
SRA | SRR1803190 |
---|---|
ENA | SRR1803190 |
BioProject | PRJNA275386 |
Experiment Details
Title | GM19240_Rep1 |
---|
Sample Details
Run Accession | SRR1803190 |
---|---|
Total Number Of Spots (Original File)) | 155542963 |
Total Number Of Bases (Original File) | 7777148150 |
Average Read Length | 50 |
Original File Size (Mb) | 4628 |
Experiment Id | SRX876767 |
Library Strategy | OTHER |
Library Selection | other |
Library Source | TRANSCRIPTOMIC |
Library Layout | SINGLE |
Insert Size | 0 |
Insert Deviation | 0 |
Platform | ILLUMINA |
Model | Illumina HiSeq 2000 |
Sra Project Accession (Srp) | SRP055009 |
Pubmed Id | 26297486 |
Sample | SRS845381 |
Biosample | SAMN03344002 |
Sample Type | simple |
Organism Taxid | 9606 |
Organism | Homo sapiens |
Sample Name | GSM1609421 |
Center Name | GEO |
Submission | SRA241011 |
Month | 2 |
Year | 2015 |
Author | Cenik |
Sample Source | EBV-transformed lymphoblastoid cells |
Sample Title | GM19240_Rep1 |
Library-Type | Ribo-Seq |
Replicate-Number | 1.0 |
Inhibitor | Cycloheximide |
Cell-Line | lymphoblastoid |
Adapter Sequence | AGATCGGAAGAGCACACGTCT |
ⓘ For more Information on the columns shown here see: About