SRR1803194 (PRJNA275386)

Processing Status: Completed

General Details

View quality reports

Sample Name GSM1609425
Organism Homo sapiens
Release Date 2/2015

Sample Links

Run Details

Spots 17660537
Total Bases 883026850
Total Bases 883026850

Repository Details

SRA SRR1803194
ENA SRR1803194
BioProject PRJNA275386

Experiment Details

Title GM18526_Rep3

Sample Details

Run Accession SRR1803194
Total Number Of Spots (Original File)) 17660537
Total Number Of Bases (Original File) 883026850
Average Read Length 50
Original File Size (Mb) 470
Experiment Id SRX876771
Library Strategy OTHER
Library Selection other
Library Source TRANSCRIPTOMIC
Library Layout SINGLE
Insert Size 0
Insert Deviation 0
Platform ILLUMINA
Model Illumina HiSeq 2000
Sra Project Accession (Srp) SRP055009
Pubmed Id 26297486
Sample SRS845376
Biosample SAMN03343999
Sample Type simple
Organism Taxid 9606
Organism Homo sapiens
Sample Name GSM1609425
Center Name GEO
Submission SRA241011
Month 2
Year 2015
Author Cenik
Sample Source EBV-transformed lymphoblastoid cells
Sample Title GM18526_Rep3
Library-Type Ribo-Seq
Replicate-Number 3.0
Inhibitor Cycloheximide
Cell-Line lymphoblastoid
Adapter Sequence AGATCGGAAGAGCACACGTCT
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)
SRR1803194 Homo sapiens EBV-transformed lymphoblastoid cells lymphoblastoid Ribo-Seq Cycloheximide
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)

ⓘ For more Information on the columns shown here see: About