SRR1803195 (PRJNA275386)

General Details

View quality reports

Sample Name GSM1609426
Organism Homo sapiens
Release Date 2/2015

Sample Links

Run Details

Spots 10658437
Total Bases 532921850
Total Bases 532921850

Repository Details

SRA SRR1803195
ENA SRR1803195
BioProject PRJNA275386

Experiment Details

Title GM18507_Rep1

Sample Details

Run Accession SRR1803195
Total Number Of Spots (Original File)) 10658437
Total Number Of Bases (Original File) 532921850
Average Read Length 50
Original File Size (Mb) 273
Experiment Id SRX876772
Library Strategy OTHER
Library Selection other
Library Source TRANSCRIPTOMIC
Library Layout SINGLE
Insert Size 0
Insert Deviation 0
Platform ILLUMINA
Model Illumina HiSeq 2000
Sra Project Accession (Srp) SRP055009
Pubmed Id 26297486
Sample SRS845375
Biosample SAMN03344000
Sample Type simple
Organism Taxid 9606
Organism Homo sapiens
Sample Name GSM1609426
Center Name GEO
Submission SRA241011
Month 2
Year 2015
Author Cenik
Sample Source EBV-transformed lymphoblastoid cells
Sample Title GM18507_Rep1
Library-Type Ribo-Seq
Replicate-Number 1.0
Inhibitor Cycloheximide
Cell-Line lymphoblastoid
Adapter Sequence AGATCGGAAGAGCACACGTCT
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)
SRR1803195 Homo sapiens EBV-transformed lymphoblastoid cells lymphoblastoid Ribo-Seq Cycloheximide
Run Accession Study Accession Scientific Name Description Cell Line Library Type Treatment Trips-Viz GWIPS-viz Reads BAM BigWig (F) BigWig (R)

ⓘ For more Information on the columns shown here see: About